Request A Quote
Contact us to discuss how we can help you achieve your research goals
Services

16S/18S/ITS Amplicon Metagenomic Sequencing

Introduction to Amplicon Metagenomic Sequencing

16S/18S/ITS Amplicon Metagenomic Sequencing is an ultra-deep DNA sequencing method that focuses on sequencing specific target regions (amplicons). Short (<500bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed by next generation sequencing (NGS) technology, to identify and differentiate multiple microbial species from complicated samples. Amplicon metagenomic sequencing is designated to sequence the target genes of 16S ribosomal RNA (rRNA), or 18S rRNA and Internal Transcribed Spacer (ITS) rRNA by universal primers, to describe and compare the phylogeny and taxonomy of bacteria (and archaea) and fungi (such as yeasts, moulds and etc.), respectively.

Novogene amplicon metagenomic sequencing services provide to efficiently screen for variants and target organisms, and describe and compare the diversity of multiple complex environments. The approach is frequently used in population and community microbial ecology studies, phylogenetic reconstruction of target microbial groups, identification of individual species in pure cultures, and detection of organisms of interest (pathogens or beneficial), among many others.

How does of 16S/18S/ITS Amplicon Metagenomic Sequencing work?

Amplicon metagenomic sequencing is an effective way to investigate all microorganisms present in diverse samples, including:

  • Targeting and identifying the organisms of interest
  • Annotating and classifying plentiful microorganisms in one assay, to obtain a complete composition of microbial communities
  • Distinction of bacteria and archaea (16S), or fungi and other eukaryotes (ITS/18S)
  • Detection of pathogens, microorganism contamination, soil bacterial benefits and etc.
  • Analyzing samples from physiological fluids or tissues to diagnose disease and cancers

Advantages of Novogene Amplicon Metagenomic Sequencing

Amplicon metagenomic sequencing is considerably simpler, faster and more efficient, compared with the whole microbial genome sequencing by separating each single species in the samples. Based on its highly targeted characteristics and multiplexing, information on thousands of amplicons is obtained by specific amplification in a single run without host contamination. High coverage is achieved, and resequencing is possible even in GC-rich regions.

Novogene has rich experience with amplicon projects and recently developed new pipelines to sequence amplicons using both short reads and long reads (full-length) technology for 16S and 18S amplicons. At Novogene, Amplicon metagenomic sequencing services can help retain a great level of flexibility in the experimental design to get analysis and clustering by both OUT (operational taxonomic units) and ASV (DADA2) pipelines. Customized analysis can also be available on the online Qiime 2 platform at will.

Primers applied to Amplicon Metagenomic Sequencing

Types Amplified Region Fragment Length Primers Sequences (5’- 3’)
Bacterial 16S V4 300 bp 515F GTGCCAGCMGCCGCGGTAA
806R GGACTACHVGGGTWTCTAAT
V3-V4 470 bp 341F CCTAYGGGRBGCASCAG
806R GGACTACNNGGGTATCTAAT
V4-V5 450 bp 515F GTGCCAGCMGCCGCGGTAA
907R CCGTCAATTCCTTTGAGTTT
V5-V7 (for endophytic) 435 bp 799F AACMGGATTAGATACCCKG
1193R ACGTCATCCCCACCTTCC
Archaeal 16S V4-V5 400-500 bp Arch519F CAGCCGCCGCGGTAA
Arch915R GTGCTCCCCCGCCAATTCCT
Types Amplified Region Fragment Length Primers Sequences (5’- 3’)
Fungal 18S V4 350 bp 528F GCGGTAATTCCAGCTCCAA
706R AATCCRAGAATTTCACCTCT
Fungal ITS ITS1 200-400 bp ITS5-1737F GGAAGTAAAAGTCGTAACAAGG
ITS2-2043R GCTGCGTTCTTCATCGATGC
ITS2 380 bp ITS3-2024F GCATCGATGAAGAACGCAGC
ITS4-2409R TCCTCCGCTTATTGATATGC
ITS1-1F (for endophytic) 200-400 bp ITS1-1F-F CTTGGTCATTTAGAGGAAGTAA
ITS1-1F-R GCTGCGTTCTTCATCGATGC

Amplicon Specifications: DNA Sample Requirements

Sample Type Amount Volume Purity
Genomic DNA ≥ 200ng ≥ 20μL OD 260/280 = 1.8-2.0

Note: Sample amounts displayed are for reference only. Download the Service Specifications or Sample Requirements to learn more. For detailed information, please contact us.

Amplicon Specifications: Sequencing and Analysis

Sequencing Platform Illumina NovaSeq 6000
Read Length Paired-end 250 bp
Data Output 30K/50K/100K raw tags
Standard Data Analysis
  • OTUs cluster and phylogenetic relationship construction
  • Species annotation
  • Alpha & Beta diversity analysis
  • Ternary plot
  • NMDS & LefSE analysis
  • Metastats analysis
  • Species T-test analysis
  • MRPP, ANOSIM, PERMANOVA, AMOVA analysis
  • Comparative analysis of alpha and beta diversity indices
  • Note: Analysis contents displayed are for reference only. Download the Service Specifications to learn more. For detailed information, please contact us with your customized requests.

    Project Workflow of Novogene Amplicon Metagenomic Sequencing Services

    The workflow for a new project starts with the sample preparation and subsequent quality control. Once the quality of the DNA sample is assured, PCR amplification will perform on target regions (amplicons). Amplicons are purified for library preparation. Library quality control takes step and sequencing is performed by sequencing by synthesis (SBS) technology used in the Illumina NovaSeq 6000 platform subsequently. Bioinformatics analysis is on-demand to conduct after the data quality control, and high-quality results and publication-ready figures are made available.

    Publications with Amplicon Metagenomic Sequencing

    Amplicon Metagenomic Sequencing is a powerful tool for researchers aiming at the identification and differentiation of microbial species, either using OTUs or ASVs. With 16S/18S/ITS rRNA sequencing results, the microbial diversity of the environment through the Alpha (α) and Beta (β) diversity analysis can be characterized, to identify, describe, and track microorganisms of interest. Here is a list of featured publications that have used Novogene Amplicon Metagenomic Sequencing services.

    Results of OTU Cluster & Annotation Analysis

    Novogene Amplicon Results of OTU Cluster & Annotation Analysis


    Species Abundance Heatmap

    Novogene Amplicon Species Abundance Heatmap


    Venn Diagram

    Novogene Amplicon Venn Diagram


    Taxonomy Tree for A Single Sample

    Novogene Amplicon Taxonomy Tree for A Single Sample


    Rarefaction & Rank Abundance Curves by Individual Sample

    Novogene Amplicon Rarefaction & Rank Abundance Curves by Individual Sample


    β-diversity Heatmap

    Novogene Amplicon β-diversity Heatmap


    Principal Component Analysis (PCA) based in OTUs

    Novogene Amplicon Principal Component Analysis (PCA) based in OTUs


    UPGMA Cluster Tree based on Weighted Unifrac Distance

    Novogene Amplicon UPGMA Cluster Tree based on Weighted Unifrac Distance


    Cladogram of LEfSe Analysis

    Novogene Amplicon Cladogram of LEfSe Analysis


    Relative Abundance on Phylum

    Novogene Amplicon Relative Abundance on Phylum

    More Research Services