Service OverviewNovogene DataContact Us
Amplicon sequencing
is frequently used to identify and differentiate microbial species. Short (< 500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR, analyzed using NGS technology, and the resulting sequences are compared against microbial databases.
For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene, and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.
At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.
* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.
is frequently used to identify and differentiate microbial species. Short (< 500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR, analyzed using NGS technology, and the resulting sequences are compared against microbial databases.For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene, and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.
At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.
The Novogene Advantage
- Highly experienced: We have sequenced over 170,000 samples, resulting in nearly 30 published articles.
- Outstanding service: We provide high-quality sequencing, an efficient standard workflow, fast turnaround time, and bioinformatics analyses at a cost-effective price.
- Effective methodology: Our method features high amplification efficiency of sample DNA (> 95%) and uses PCR free libraries to avoid amplification bias.
- Comprehensive analysis: We provide expert bioinformatics analyses using the latest sequence databases and software, generating high-quality, publication-ready data.
Project Workflow
Sequencing Strategy
- 130-470 bp insert DNA library
- HiSeq platform, paired-end 250 bp
| Target | Region | Fragment Length | Primer | Primer sequences (5’- 3’) |
|---|---|---|---|---|
| Bacterial 16S rDNA | V4 | 292 bp | 515F | GTGCCAGCMGCCGCGGTAA |
| 806R | GGACTACHVGGGTWTCTAAT | |||
| V3-V4 | 466 bp | 341F | CCTAYGGGRBGCASCAG | |
| 806R | GGACTACNNGGGTATCTAAT | |||
| V4-V5 | 393 bp | 515F | GTGCCAGCMGCCGCGGTAA | |
| 907R | CCGTCAATTCCTTTGAGTTT | |||
| Archaeal 16S rDNA | V4 | 397 bp | 519F | CAGCCGCCGCGGTAA |
| 915R | GTGCTCCCCCGCCAATTCCT | |||
| 288 bp | U519F | CAGYMGCCRCGGKAAHACC | ||
| 806R | GGACTACNSGGGTMTCTAAT | |||
| Fungal 18S rDNA | V4 | 179 bp | 528F | GCGGTAATTCCAGCTCCAA |
| 706R | AATCCRAGAATTTCACCTCT | |||
| V9 | 131 bp | 1380F | CCCTGCCHTTTGTACACAC | |
| 1510R | CCTTCYGCAGGTTCACCTAC | |||
| Fungal ITS* | ITS1 | 307 bp | ITS5-1737F | GGAAGTAAAAGTCGTAACAAGG |
| ITS2-2043R | GCTGCGTTCTTCATCGATGC | |||
| ITS2 | 386 bp | ITS3 | GCATCGATGAAGAACGCAGC | |
| ITS4 | TCCTCCGCTTATTGATATGC |
Data Quality Guarantee
- The amount of data for each sample is not less than 30,000 tags, 50,000 tags or 100,000 tags.
Sample Requirements
- DNA amount: ≥ 150 ng (for one library preparation*)
*Multiple DNA samples can be mixed together to make one library construction. - PCR product: ≥ 400 ng (for one library preparation)
- DNA concentration: ≥ 20 ng/μl
- Purity: OD260/280 = 1.8 - 2.0 without degradation and contamination
- Amplified region should be less than 470 bp.
Turnaround Time
- Within 15 working days from verification of sample quality (without data analysis)
- Additional 11 working days for data analysis
Recommended Sequencing Depth
- Three strategies: 30,000 tags, 50,000 tags, or 100,000 tags
Analysis Pipeline
List of Analyses
- Data quality control
- OTUs (Operational Taxonomic Units) clustering and filtering
- Alpha-diversity analysis, including rarefaction curve, Chao-1 curve, Shannon curve, rank abundance curve, and alpha indices table
- OTUs analysis and species annotation, including Krona results, phylogenetic composition analysis, phylogenetic tree, heatmap, and taxonomic tree
- Beta-diversity analysis, including unweighted UniFrac distance heatmap, PCA (principal component analysis), PCoA (principal co-ordinates analysis), UPGMA (unweighted pair-group method with arithmetic means), and NMDS (Non-metric multidimensional scaling) analysis
- Multi-variate statistical analysis, including LEfSe (LDA effect size) analysis, metastats analysis, ANOSIM, and MRPP analysis
The following study utilized Novogene's amplicon sequencing services.
Microbiota modulate tumoral immune surveillance in lung through a T17 immune cell-dependent mechanism
Cancer Research, 74:4030 (2014)
In this study on the effects of commensal bacteria on immune homeostasis, Novogene technology was used to monitor the changes in commensal bacteria following antibiotic treatment, using stool samples from treated and untreated mice. Analysis of 16S rDNA using the Illumina MiSeq platform showed that multiple taxonomic groups were present, and that their relative abundance was altered by antibiotic treatment.
Figure. Microbiota variations after different antibiotic treatments
Microbiota modulate tumoral immune surveillance in lung through a T17 immune cell-dependent mechanism
Cancer Research, 74:4030 (2014)
In this study on the effects of commensal bacteria on immune homeostasis, Novogene technology was used to monitor the changes in commensal bacteria following antibiotic treatment, using stool samples from treated and untreated mice. Analysis of 16S rDNA using the Illumina MiSeq platform showed that multiple taxonomic groups were present, and that their relative abundance was altered by antibiotic treatment.
Figure. Microbiota variations after different antibiotic treatments
Examples of Publications Using Novogene’s Services
| Journal | Title |
|---|---|
| Cancer Research, 74:4030-4041 (2014) | Microbiota modulate tumoral immune surveillance in lung through a γδT17 immune cell-dependent mechanism. |
| Environmental science & technology, 49:7152-7160 (2015) | Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils. |
| Chemical Engineering Journal, 285:319-330 (2016) | Microbial diversity in combined UAF–UBAF system with novel sludge and coal cinder ceramic fillers for tetracycline wastewater treatment. |
| Environment international, 92:1-10 (2016) | Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil. |
| Water Research, 102:445-452 (2016) | Cr(VI) reduction coupled with anaerobic oxidation of methane in a laboratory reactor. |