Service OverviewNovogene DataContact Us
Amplicon sequencing
is frequently used to identify and differentiate microbial species. Short (<500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed using NGS technology, and the resulting sequences are compared against microbial databases.
For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.
At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants, to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.
* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.
is frequently used to identify and differentiate microbial species. Short (<500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed using NGS technology, and the resulting sequences are compared against microbial databases.For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.
At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants, to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.
The Novogene Advantage
- Highly experienced: We have sequenced over 170,000 samples, resulting in nearly 30 published articles.
- Outstanding service: We provide high-quality sequencing, an efficient standard workflow, fast turnaround time, and bioinformatics analyses at a cost-effective price.
- Effective methodology: Our method features high amplification efficiency of sample DNA (>95%) and uses PCR free libraries to avoid amplification bias.
- Comprehensive analysis: We provide expert bioinformatics analyses using the latest sequence databases and software, generating high-quality, publication-ready data.
Project Workflow
Sequencing Strategy
- 130-470 bp insert DNA library
- Ion S5, Single-end 400/Single-end 600
| Target | Region | Fragment Length | Primer | Primer sequences (5’- 3’) |
|---|---|---|---|---|
| Bacterial 16S rDNA | V4 | 292 bp | 515F | GTGCCAGCMGCCGCGGTAA |
| 806R | GGACTACHVGGGTWTCTAAT | |||
| V3-V4 | 466 bp | 341F | CCTAYGGGRBGCASCAG | |
| 806R | GGACTACNNGGGTATCTAAT | |||
| V4-V5 | 393 bp | 515F | GTGCCAGCMGCCGCGGTAA | |
| 907R | CCGTCAATTCCTTTGAGTTT | |||
| Archaeal 16S rDNA | V4 | 397 bp | 519F | CAGCCGCCGCGGTAA |
| 915R | GTGCTCCCCCGCCAATTCCT | |||
| 288 bp | U519F | CAGYMGCCRCGGKAAHACC | ||
| 806R | GGACTACNSGGGTMTCTAAT | |||
| Fungal 18S rDNA | V4 | 179 bp | 528F | GCGGTAATTCCAGCTCCAA |
| 706R | AATCCRAGAATTTCACCTCT | |||
| V9 | 131 bp | 1380F | CCCTGCCHTTTGTACACAC | |
| 1510R | CCTTCYGCAGGTTCACCTAC | |||
| Fungal ITS* | ITS1 | 307 bp | ITS5-1737F | GGAAGTAAAAGTCGTAACAAGG |
| ITS2-2043R | GCTGCGTTCTTCATCGATGC | |||
| ITS2 | 386 bp | ITS3 | GCATCGATGAAGAACGCAGC | |
| ITS4 | TCCTCCGCTTATTGATATGC |
Data Quality Guarantee
- The amount of data for each sample is not less than 30,000 reads, 50,000 reads or 100,000 reads.
Sample Requirements
| Sample Type | Remarks | Amount | Fragment Size | Concentration | Volume | Purity |
|---|---|---|---|---|---|---|
| Genomic DNA | - | ≥ 150 ng | - | ≥5 ng/μL | ≥ 30 μl | OD260/280=1.8-2.0 |
Turnaround Time
- Within 15 working days from verification of sample quality (without data analysis ≤100 samples)
- Additional 5 working days for data analysis
Recommended Sequencing Depth
- Three strategies: 30,000 reads, 50,000 reads, or 100,000 reads
Analysis Pipeline
List of Analyses
- Data quality control
- OTUs (Operational Taxonomic Units) clustering and filtering
- Alpha-diversity analysis, including rarefaction curve, Chao-1 curve, Shannon curve, rank abundance curve, and alpha indices table
- OTUs analysis and species annotation, including Krona results, phylogenetic composition analysis, phylogenetic tree, heatmap, and taxonomic tree
- Beta-diversity analysis, including unweighted UniFrac distance heatmap, PCA (principal component analysis), PCoA (principal co-ordinates analysis), UPGMA (unweighted pair-group method with arithmetic means), and NMDS (Non-metric multidimensional scaling) analysis
- Multi-variate statistical analysis, including LEfSe (LDA effect size) analysis, metastats analysis, ANOSIM, and MRPP analysis
Project Examples
The following studies utilized Novogene's amplicon sequencing services.The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner
Nature Communication 8: 13839 (2017)
This study explored how gut microbiota maintain homeostasis of a specific type of T cell in the liver, i.e., liver-resident IL-17A-producing γδT (γδT-17) cells, using Novogene’s amplicon sequencing service to examine microbial diversity. γδT-17 cells are key contributors to maintaining the immune response to microbiota, and comparison of these cells from various organs showed that hepatic γδT cells produce high levels of the pro-inflammatory cytokine IL-17A. When treated with various antibiotics, both the γδT-17 cell number and the bacteria species diversity were maintained homeostasis even though different compositions of microbes were induced. Further study showed that the proliferation of γδT-17 cells is promoted by CD1d presentation of commensal lipid antigens. This study is the first to describe the unique impacts of the gut microbiota on the functions of liver-resident γδT cells.
Continental-scale pollution of estuaries with antibiotic resistance genes
Nature Microbiology, 2:16270 (2017)
Aquatic ecosystems are highly susceptible to anthropogenic impacts, including pollutants such as antibiotic resistance genes (ARGs). The spread of these resistance genes into aquatic environments poses a health risk to human and animal populations. To study the factors shaping the diversity and abundance of ARGs in estuaries, researchers sampled sediment from estuaries in China. High-throughput quantitative PCR determined that over 200 ARGs were present, with 18 found in all sediment samples. Amplicon sequencing of the 16s rRNA gene was performed by Novogene to assess the abundance of bacterial cells and bacterial community composition in sediments, which was found to be consistent across different estuaries, indicating that bacterial composition was not a key contributor to ARG variance. ARG abundance was positively correlated with antibiotic residues and socio-economic parameters, including total population, gross domestic product, and sewage and aquaculture production. These results indicate that human activity is largely responsible for the increased abundance and spread of ARGs in aquatic environments. The study emphasizes the environmental, agricultural, and medical consequences that can arise from such pollution. Additionally, it demonstrates how amplicon sequencing can be used to study microbial communities in aquatic environments.
