Leading Edge Genomic Services & Solutions

Amplicon Sequencing

Service Overview
Novogene Data
Contact Us

Amplicon sequencingAmplicon Sequencing is frequently used to identify and differentiate microbial species. Short (<500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed using NGS technology, and the resulting sequences are compared against microbial databases. For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies. At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants, to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.

The Novogene Advantage

  • Highly experienced: We have sequenced over 170,000 samples, resulting in nearly 30 published articles.
  • Outstanding service: We provide high-quality sequencing, an efficient standard workflow, fast turnaround time, and bioinformatics analyses at a cost-effective price.
  • Effective methodology: Our method features high amplification efficiency of sample DNA (>95%) .
  • Comprehensive analysis: We provide expert bioinformatics analyses using the latest sequence databases and software, generating high-quality, publication-ready data.

Project Workflow

amplicon sequencing and 16s sequencing workflow

Sequencing Strategy

  • 130-470 bp insert DNA library
  • Illumina platform paired-end 250 bp
Target Region Fragment Length Primer Primer sequences (5’- 3’)
Bacterial 16S rDNA V4 292 bp 515F GTGCCAGCMGCCGCGGTAA
806R GGACTACHVGGGTWTCTAAT
V3-V4 466 bp 341F CCTAYGGGRBGCASCAG
806R GGACTACNNGGGTATCTAAT
V4-V5 393 bp 515F GTGCCAGCMGCCGCGGTAA
907R CCGTCAATTCCTTTGAGTTT
Archaeal 16S rDNA V4 397 bp 519F CAGCCGCCGCGGTAA
915R GTGCTCCCCCGCCAATTCCT
288 bp U519F CAGYMGCCRCGGKAAHACC
806R GGACTACNSGGGTMTCTAAT
Fungal 18S rDNA V4 179 bp 528F GCGGTAATTCCAGCTCCAA
706R AATCCRAGAATTTCACCTCT
V9 131 bp 1380F CCCTGCCHTTTGTACACAC
1510R CCTTCYGCAGGTTCACCTAC
Fungal ITS* ITS1 307 bp ITS5-1737F GGAAGTAAAAGTCGTAACAAGG
ITS2-2043R GCTGCGTTCTTCATCGATGC
ITS2 386 bp ITS3 GCATCGATGAAGAACGCAGC
ITS4 TCCTCCGCTTATTGATATGC
* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.

Data Quality Guarantee

  • The amount of data for each sample is not less than 30,000 reads, 50,000 reads or 100,000 reads.

Sample Requirements

Sample Type Remarks Amount Fragment Size Concentration Volume Purity
Genomic DNA - ≥ 150 ng - ≥5 ng/μL ≥ 30 μl OD260/280=1.8-2.0

Turnaround Time

  • Within 25 working days from verification of sample quality (without data analysis ≤150 samples)
  • Additional 5 working days for data analysis

Recommended Sequencing Depth

  • Three strategies: 30,000 reads, 50,000 reads, or 100,000 reads

Analysis Pipeline

amplicon sequencing and 16s sequencing analysis pipeline

List of Analyses

  • Data quality control
  • OTUs (Operational Taxonomic Units) clustering and filtering
  • Alpha-diversity analysis, including rarefaction curve, Chao-1 curve, Shannon curve, rank abundance curve, and alpha indices table
  • OTUs analysis and species annotation, including Krona results, phylogenetic composition analysis, phylogenetic tree, heatmap, and taxonomic tree
  • Beta-diversity analysis, including unweighted UniFrac distance heatmap, PCA (principal component analysis), PCoA (principal co-ordinates analysis), UPGMA (unweighted pair-group method with arithmetic means), and NMDS (Non-metric multidimensional scaling) analysis
  • Multi-variate statistical analysis, including LEfSe (LDA effect size) analysis, metastats analysis, ANOSIM, and MRPP analysis

Project Examples

The following studies utilized Novogene's amplicon sequencing services. The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner Nature Communication 8: 13839 (2017) This study explored how gut microbiota maintain homeostasis of a specific type of T cell in the liver, i.e., liver-resident IL-17A-producing γδT (γδT-17) cells, using Novogene’s amplicon sequencing service to examine microbial diversity. γδT-17 cells are key contributors to maintaining the immune response to microbiota, and comparison of these cells from various organs showed that hepatic γδT cells produce high levels of the pro-inflammatory cytokine IL-17A. When treated with various antibiotics, both the γδT-17 cell number and the bacteria species diversity were maintained homeostasis even though different compositions of microbes were induced. Further study showed that the proliferation of γδT-17 cells is promoted by CD1d presentation of commensal lipid antigens. This study is the first to describe the unique impacts of the gut microbiota on the functions of liver-resident γδT cells.
Amplicon
Figure. 16S rDNA sequencing reveals that commensal microbe load positively correlates with hepatic γδT-17 cell numbers
Continental-scale pollution of estuaries with antibiotic resistance genes Nature Microbiology, 2:16270 (2017) Aquatic ecosystems are highly susceptible to anthropogenic impacts, including pollutants such as antibiotic resistance genes (ARGs). The spread of these resistance genes into aquatic environments poses a health risk to human and animal populations. To study the factors shaping the diversity and abundance of ARGs in estuaries, researchers sampled sediment from estuaries in China. High-throughput quantitative PCR determined that over 200 ARGs were present, with 18 found in all sediment samples. Amplicon sequencing of the 16s rRNA gene was performed by Novogene to assess the abundance of bacterial cells and bacterial community composition in sediments, which was found to be consistent across different estuaries, indicating that bacterial composition was not a key contributor to ARG variance. ARG abundance was positively correlated with antibiotic residues and socio-economic parameters, including total population, gross domestic product, and sewage and aquaculture production. These results indicate that human activity is largely responsible for the increased abundance and spread of ARGs in aquatic environments. The study emphasizes the environmental, agricultural, and medical consequences that can arise from such pollution. Additionally, it demonstrates how amplicon sequencing can be used to study microbial communities in aquatic environments.
Figure. ARG profiles in estuarine sediments

Examples of Publications Using Novogene’s Services

Journal Title
Cancer Research, 74:4030-4041 (2014) Microbiota modulate tumoral immune surveillance in lung through a γδT17 immune cell-dependent mechanism.
Environmental science & technology, 49:7152-7160 (2015) Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.
Chemical Engineering Journal, 285:319-330 (2016) Microbial diversity in combined UAF–UBAF system with novel sludge and coal cinder ceramic fillers for tetracycline wastewater treatment.
Environment international, 92:1-10 (2016) Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil.
Water Research, 102:445-452 (2016) Cr(VI) reduction coupled with anaerobic oxidation of methane in a laboratory reactor.
Nature Communications, 7:13839 (2017) The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner.
Nature Microbiology, 2:16270 (2017) Continental-scale pollution of estuaries with antibiotic resistance genes.
EMBO Molecular Medicine, 9(4):448-461 (2017) Faecal microbiota transplantation protects against radiation-induced toxicity.
Nature Communications, 9: 2020 (2018) Hypoxia induces senescence of bone marrow mesenchymal stem cells via altered gut microbiota.