Leading Edge Genomic Services & Solutions

Amplicon Sequencing

Service Overview
Novogene Data
Contact Us

Amplicon sequencingAmplicon Sequencing is frequently used to identify and differentiate microbial species. Short (< 500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR, analyzed using NGS technology, and the resulting sequences are compared against microbial databases.

For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene, and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.

At Novogene, we have sequenced over 170,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.

The Novogene Advantage

  • Highly experienced: We have sequenced over 170,000 samples, resulting in nearly 30 published articles.
  • Outstanding service: We provide high-quality sequencing, an efficient standard workflow, fast turnaround time, and bioinformatics analyses at a cost-effective price.
  • Effective methodology: Our method features high amplification efficiency of sample DNA (> 95%) and uses PCR free libraries to avoid amplification bias.
  • Comprehensive analysis: We provide expert bioinformatics analyses using the latest sequence databases and software, generating high-quality, publication-ready data.

Project Workflow

amplicon sequencing and 16s sequencing workflow

Sequencing Strategy

  • 130-470 bp insert DNA library
  • HiSeq platform, paired-end 250 bp
TargetRegionFragment LengthPrimerPrimer sequences (5’- 3’)
Bacterial
16S rDNA
V4292 bp515FGTGCCAGCMGCCGCGGTAA
806RGGACTACHVGGGTWTCTAAT
V3-V4466 bp341FCCTAYGGGRBGCASCAG
806RGGACTACNNGGGTATCTAAT
V4-V5393 bp515FGTGCCAGCMGCCGCGGTAA
907RCCGTCAATTCCTTTGAGTTT
Archaeal
16S rDNA
V4397 bp519FCAGCCGCCGCGGTAA
915RGTGCTCCCCCGCCAATTCCT
288 bpU519FCAGYMGCCRCGGKAAHACC
806RGGACTACNSGGGTMTCTAAT
Fungal
18S rDNA
V4179 bp528FGCGGTAATTCCAGCTCCAA
706RAATCCRAGAATTTCACCTCT
V9131 bp1380FCCCTGCCHTTTGTACACAC
1510RCCTTCYGCAGGTTCACCTAC
Fungal
ITS*
ITS1307 bpITS5-1737FGGAAGTAAAAGTCGTAACAAGG
ITS2-2043RGCTGCGTTCTTCATCGATGC
ITS2386 bpITS3GCATCGATGAAGAACGCAGC
ITS4TCCTCCGCTTATTGATATGC
* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.

Data Quality Guarantee

  • The amount of data for each sample is not less than 30,000 tags, 50,000 tags or 100,000 tags.

Sample Requirements

  • DNA amount: ≥ 240 ng (ITS), ≥ 120 ng (16S) (for one library preparation)
    *Multiple DNA samples can be mixed together to make one library construction.
  • PCR product: ≥ 400 ng (for one library preparation)
  • DNA concentration: ≥ 12 ng/ul (ITS), ≥ 6 ng/nl (16S), ≥ 20 ng/μl (PCR product)
  • DNA volume: ≥ 20 μl (genomic DNA), ≥ 10 μl (PCR product)
  • Purity: No degradation, no DNA contamination
  • Fragment size < 450 bp

Turnaround Time

  • Within 15 working days from verification of sample quality (without data analysis)
  • Additional 11 working days for data analysis

Recommended Sequencing Depth

  • Three strategies: 30,000 tags, 50,000 tags, or 100,000 tags

Analysis Pipeline

amplicon sequencing and 16s sequencing analysis pipeline

List of Analyses

  • Data quality control
  • OTUs (Operational Taxonomic Units) clustering and filtering
  • Alpha-diversity analysis, including rarefaction curve, Chao-1 curve, Shannon curve, rank abundance curve, and alpha indices table
  • OTUs analysis and species annotation, including Krona results, phylogenetic composition analysis, phylogenetic tree, heatmap, and taxonomic tree
  • Beta-diversity analysis, including unweighted UniFrac distance heatmap, PCA (principal component analysis), PCoA (principal co-ordinates analysis), UPGMA (unweighted pair-group method with arithmetic means), and NMDS (Non-metric multidimensional scaling) analysis
  • Multi-variate statistical analysis, including LEfSe (LDA effect size) analysis, metastats analysis, ANOSIM, and MRPP analysis

Project Example

The following study utilized Novogene's amplicon sequencing services.

The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner
Nature Communication 8: 13839 (2017)

This study explored how gut microbiota maintain homeostasis of a specific type of T cell in the liver, i.e., liver-resident IL-17A-producing γδT (γδT-17) cells, using Novogene’s amplicon sequencing service to examine microbial diversity. γδT-17 cells are key contributors to maintaining the immune response to microbiota, and comparison of these cells from various organs showed that hepatic γδT cells produce high levels of the pro-inflammatory cytokine IL-17A. When treated with various antibiotics, both the γδT-17 cell number and the bacteria species diversity were maintained homeostasis even though different compositions of microbes were induced. Further study showed that the proliferation of γδT-17 cells is promoted by CD1d presentation of commensal lipid antigens. This study is the first to describe the unique impacts of the gut microbiota on the functions of liver-resident γδT cells.

 

AmpliconFigure. 16S rDNA sequencing reveals that commensal microbe load positively correlates with hepatic γδT-17 cell numbers

Examples of Publications Using Novogene’s Services

JournalTitle
Cancer Research, 74:4030-4041 (2014)Microbiota modulate tumoral immune surveillance in lung through a γδT17 immune cell-dependent mechanism.
Environmental science & technology, 49:7152-7160 (2015)Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.
Chemical Engineering Journal, 285:319-330 (2016)Microbial diversity in combined UAF–UBAF system with novel sludge and coal cinder ceramic fillers for tetracycline wastewater treatment.
Environment international, 92:1-10 (2016)Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil.
Water Research, 102:445-452 (2016)Cr(VI) reduction coupled with anaerobic oxidation of methane in a laboratory reactor.
Nature Communications, 7:13839 (2017)The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner.
EMBO Molecular Medicine, 9(4):448-461 (2017)Faecal microbiota transplantation protects against radiation-induced toxicity.
  Whole Genome Sequencing on HiSeq X (Human/ Animal/ Plant)
  Whole Exome Sequencing
  mRNA-Seq
  LncRNA Sequencing
  Small RNA Sequencing
  Whole Genome Bisulfite Sequencing
  ChIP-Seq
  Animal & Plant Re-Sequencing
  de novo Sequencing
  Pan-genome Sequencing
  Metagenomic Sequencing
  Single-cell DNA Sequencing
  Single-cell RNA Sequencing
  16S/18S/ITS Amplicon
  HiSeq Lane Sequencing
  NovaSeq Flowcell Sequencing
  Others- please specify
  Human
  Others