Leading Edge Genomic Services & Solutions

Amplicon Sequencing

Service Overview
Novogene Data
Contact Us

Amplicon sequencingAmplicon Sequencing is frequently used to identify and differentiate microbial species. Short (< 500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR, analyzed using NGS technology, and the resulting sequences are compared against microbial databases.

For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene, and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.

At Novogene, we have sequenced over 50,000 microbial samples for our customers. Our standard bioinformatics analyses include alpha-diversity analysis, OTU analysis, species annotation, beta-diversity analysis, and multi-variate statistical analysis. Applications range from identifying a single species in pure culture to characterizing the microbiota of animals or plants to comparing species diversity and population structure in various environmental sources or geographic regions. Our specialists can advise you on the appropriate analyses for your project.

The Novogene Advantage

  • Highly experienced: We have sequenced over 50,000 samples, resulting in nearly 20 published articles.
  • Outstanding service: We provide high-quality sequencing, an efficient standard workflow, fast turnaround time, and bioinformatics analyses at a cost-effective price.
  • Effective methodology: Our method features high amplification efficiency of sample DNA (> 95%) and uses PCR free libraries to avoid amplification bias.
  • Comprehensive analysis: We provide expert bioinformatics analyses using the latest sequence databases and software, generating high-quality, publication-ready data.

Project Workflow

amplicon sequencing and 16s sequencing workflow

Sequencing Strategy

  • 130-470 bp insert DNA library
  • HiSeq platform, paired-end 250 bp
TargetRegionFragment LengthPrimerPrimer sequences (5’- 3’)
Bacterial
16S rDNA
V4292 bp515FGTGCCAGCMGCCGCGGTAA
806RGGACTACHVGGGTWTCTAAT
V3-V4466 bp341FCCTAYGGGRBGCASCAG
806RGGACTACNNGGGTATCTAAT
V4-V5393 bp515FGTGCCAGCMGCCGCGGTAA
907RCCGTCAATTCCTTTGAGTTT
Archaeal
16S rDNA
V4397 bp519FCAGCCGCCGCGGTAA
915RGTGCTCCCCCGCCAATTCCT
288 bpU519FCAGYMGCCRCGGKAAHACC
806RGGACTACNSGGGTMTCTAAT
Fungal
18S rDNA
V4179 bp528FGCGGTAATTCCAGCTCCAA
706RAATCCRAGAATTTCACCTCT
V9131 bp1380FCCCTGCCHTTTGTACACAC
1510RCCTTCYGCAGGTTCACCTAC
Fungal
ITS*
ITS1307 bpITS5-1737FGGAAGTAAAAGTCGTAACAAGG
ITS2-2043RGCTGCGTTCTTCATCGATGC
ITS2386 bpITS3GCATCGATGAAGAACGCAGC
ITS4TCCTCCGCTTATTGATATGC
* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.

Data Quality Guarantee

  • The amount of data for each sample is not less than 30,000 tags, 50,000 tags or 100,000 tags.

Sample Requirements

  • DNA amount: ≥ 150 ng (for one library preparation*)
    *Multiple DNA samples can be mixed together to make one library construction.
  • PCR product: ≥ 400 ng (for one library preparation)
  • DNA concentration: ≥ 20 ng/μl
  • Purity: OD260/280 = 1.8 - 2.0 without degradation and contamination
  • Amplified region should be less than 470 bp.

Turnaround Time

  • Within 15 working days from verification of sample quality (without data analysis)
  • Additional 11 working days for data analysis

Recommended Sequencing Depth

  • Three strategies: 30,000 tags, 50,000 tags, or 100,000 tags

Analysis Pipeline

amplicon sequencing and 16s sequencing analysis pipeline

List of Analyses

  • Data quality control
  • OTUs (Operational Taxonomic Units) clustering and filtering
  • Alpha-diversity analysis, including rarefaction curve, Chao-1 curve, Shannon curve, rank abundance curve, and alpha indices table
  • OTUs analysis and species annotation, including Krona results, phylogenetic composition analysis, phylogenetic tree, heatmap, and taxonomic tree
  • Beta-diversity analysis, including unweighted UniFrac distance heatmap, PCA (principal component analysis), PCoA (principal co-ordinates analysis), UPGMA (unweighted pair-group method with arithmetic means), and NMDS (Non-metric multidimensional scaling) analysis
  • Multi-variate statistical analysis, including LEfSe (LDA effect size) analysis, metastats analysis, ANOSIM, and MRPP analysis
The following study utilized Novogene's amplicon sequencing services.

Microbiota modulate tumoral immune surveillance in lung through a T17 immune cell-dependent mechanism
Cancer Research, 74:4030 (2014)

In this study on the effects of commensal bacteria on immune homeostasis, Novogene technology was used to monitor the changes in commensal bacteria following antibiotic treatment, using stool samples from treated and untreated mice. Analysis of 16S rDNA using the Illumina MiSeq platform showed that multiple taxonomic groups were present, and that their relative abundance was altered by antibiotic treatment.

 

Amplicon Chart

Figure. Microbiota variations after different antibiotic treatments

Examples of Publications Using Novogene’s Services

JournalTitle
Cancer Research, 74:4030 (2014)Microbiota modulate tumoral immune surveillance in lung through a γδT17 immune cell-dependent mechanism.
Scientific Reports,
5:9342 (2015)
The bacterial communities associated with fecal types and body weight of rex rabbits.
Environmental science & technology, 49 (12):7152 (2015)Community structure and soil pH determine chemoautotrophic carbon dioxide fixation in drained paddy soils.
Journal of Hazardous Materials, 293:37 (2015)Conductive iron oxide minerals accelerate syntrophic cooperation in methanogenic benzoate degradation.
Journal of hazardous materials, 286:457 (2015)Exploring bacterial community structure and function associated with atrazine biodegradation in repeatedly treated soils.
Bioresource Technology, 167:124 (2014)Enrichment of anodic biofilm inoculated with anaerobic or aerobic sludge in single chambered air-cathode microbial fuel cells.
  Whole Genome Sequencing on HiSeq X (Human/ Animal/ Plant)
  Whole Exome Sequencing
  mRNA-Seq
  LncRNA Sequencing
  Small RNA Sequencing
  Whole Genome Bisulfite Sequencing
  ChIP-Seq
  Animal & Plant Re-Sequencing
  Genotyping by Sequencing
  de novo Sequencing
  Pan-genome Sequencing
  Metagenomic Sequencing
  Single-cell DNA Sequencing
  Single-cell RNA Sequencing
  16S/18S/ITS Amplicon
  Others- please specify
  Human
  Others